Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYG205
(Plasmid #200836)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 200836 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 5096
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli TOP10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rapZ
  • Alt name
    yhbJ
  • Species
    Escherichia coli str. K-12 substr. MG1655
  • Insert Size (bp)
    855
  • Entrez Gene
    rapZ (a.k.a. b3205, ECK3194, yhbJ)
  • Promoter P-BAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer agattagcggatcctacctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYG205 was a gift from Boris Görke (Addgene plasmid # 200836 ; http://n2t.net/addgene:200836 ; RRID:Addgene_200836)
  • For your References section:

    Role of the 5' end phosphorylation state for small RNA stability and target RNA regulation in bacteria. Schilder A, Gorke B. Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226. 10.1093/nar/gkad226 PubMed 36987877