pYG215
(Plasmid
#200837)
-
PurposeTranscribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 6232
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli TOP10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameglmZ
-
Alt namesraJ
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
Insert Size (bp)146
-
Entrez GeneglmZ (a.k.a. b4456, ECK3795, JWR0257, k19, psrA20, ryiA, sraJ)
- Promoter P-LlacO-1
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AatII (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer cgcgttggccgattcattaatgc
- 3′ sequencing primer CCCGCAAGAGGCCCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYG215 was a gift from Boris Görke (Addgene plasmid # 200837 ; http://n2t.net/addgene:200837 ; RRID:Addgene_200837) -
For your References section:
Role of the 5' end phosphorylation state for small RNA stability and target RNA regulation in bacteria. Schilder A, Gorke B. Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226. 10.1093/nar/gkad226 PubMed 36987877