Skip to main content

pYG215
(Plasmid #200837)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200837 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC101
  • Backbone size w/o insert (bp) 6232
  • Vector type
    Bacterial Expression, Synthetic Biology
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli TOP10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    glmZ
  • Alt name
    sraJ
  • Species
    Escherichia coli str. K-12 substr. MG1655
  • Insert Size (bp)
    146
  • Entrez Gene
    glmZ (a.k.a. b4456, ECK3795, JWR0257, k19, psrA20, ryiA, sraJ)
  • Promoter P-LlacO-1
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer cgcgttggccgattcattaatgc
  • 3′ sequencing primer CCCGCAAGAGGCCCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYG215 was a gift from Boris Görke (Addgene plasmid # 200837 ; http://n2t.net/addgene:200837 ; RRID:Addgene_200837)
  • For your References section:

    Role of the 5' end phosphorylation state for small RNA stability and target RNA regulation in bacteria. Schilder A, Gorke B. Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226. 10.1093/nar/gkad226 PubMed 36987877