pCW57.1-Eomes-3xT7
              
              
                (Plasmid
                
                #200888)
              
            
            
            
          - 
            PurposeInducible lentiviral expression of Eomes
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCW57.1
 - Backbone size w/o insert (bp) 9354
 - Total vector size (bp) 11613
 - 
              Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
 - 
                Selectable markersPuromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)NEB Stable
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameEomes
 - 
                    SpeciesM. musculus (mouse)
 - 
                  Insert Size (bp)2259
 - 
                        Entrez GeneEomes (a.k.a. TBR-2, Tbr2)
 - Promoter TRE promoter, Tet ON
 - 
    
        Tag
        / Fusion Protein
    
- 3xT7 (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site MluI (unknown if destroyed)
 - 3′ cloning site HpaI (unknown if destroyed)
 - 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
 - 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pCW57.1-Eomes-3xT7 was a gift from Kai Ge (Addgene plasmid # 200888 ; http://n2t.net/addgene:200888 ; RRID:Addgene_200888) - 
                
For your References section:
MLL3/MLL4 methyltransferase activities control early embryonic development and embryonic stem cell differentiation in a lineage-selective manner. Xie G, Lee JE, Senft AD, Park YK, Jang Y, Chakraborty S, Thompson JJ, McKernan K, Liu C, Macfarlan TS, Rocha PP, Peng W, Ge K. Nat Genet. 2023 Apr 3. doi: 10.1038/s41588-023-01356-4. 10.1038/s41588-023-01356-4 PubMed 37012455