Skip to main content
Addgene

pCW57.1-Neurod1-3xT7
(Plasmid #200890)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200890 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCW57.1
  • Backbone size w/o insert (bp) 9354
  • Total vector size (bp) 10563
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Neurod1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1209
  • Entrez Gene
    Neurod1 (a.k.a. BETA2, BHF-1, Nd1, Neurod, bHLHa3)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • 3xT7 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HpaI (unknown if destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-Neurod1-3xT7 was a gift from Kai Ge (Addgene plasmid # 200890 ; http://n2t.net/addgene:200890 ; RRID:Addgene_200890)
  • For your References section:

    MLL3/MLL4 methyltransferase activities control early embryonic development and embryonic stem cell differentiation in a lineage-selective manner. Xie G, Lee JE, Senft AD, Park YK, Jang Y, Chakraborty S, Thompson JJ, McKernan K, Liu C, Macfarlan TS, Rocha PP, Peng W, Ge K. Nat Genet. 2023 Apr 3. doi: 10.1038/s41588-023-01356-4. 10.1038/s41588-023-01356-4 PubMed 37012455