pCAGGS--MTS(S43A)-EGFP-V5
(Plasmid
#200933)
-
Purposeexpresses MTS(S43A)-EGFP-V5 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4859
- Total vector size (bp) 5708
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Insert Size (bp)849
-
MutationS43A in MTS
-
GenBank ID
- Promoter CAG
-
Tags
/ Fusion Proteins
- V5 (C terminal on insert)
- mitochondrial targeting sequence (MTS) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer GTTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer TATGTCCTTCCGAGTGAGAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS--MTS(S43A)-EGFP-V5 was a gift from Hung-Chun Chang (Addgene plasmid # 200933 ; http://n2t.net/addgene:200933 ; RRID:Addgene_200933)