Skip to main content

lentiGuide-puro_Panc480-MT7
(Plasmid #200941)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200941 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiGuide-puro
  • Backbone size w/o insert (bp) 8306
  • Total vector size (bp) 10542
  • Modifications to backbone
    Multiplex array of hU6 promoter, sgRNA, gRNA scaffold x7
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    multiplexed sgRNA array
  • gRNA/shRNA sequence
    GGAATCATCTTCACAGTTGT;AATATCCTGCCACCTCTAAC;TCAGTCCAGTCAAAGGTGGA;CTAATGTATGACTGAAAGCT;GAGGTGTCTAAACCATGACA;GTGCACATCTTATCTCCCTT;TTAGGGGGCCAAGAGCGTAT
  • Promoter hU6, EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aggcagggatattcaccatt
  • 3′ sequencing primer aattgtggatgaatactgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA targets specific to Panc480 cell line.

Please visit https://doi.org/10.1101/2023.04.15.537042 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiGuide-puro_Panc480-MT7 was a gift from James Eshleman (Addgene plasmid # 200941 ; http://n2t.net/addgene:200941 ; RRID:Addgene_200941)
  • For your References section:

    CRISPR-Cas9 for selective targeting of somatic mutations in pancreatic cancers. Teh SSK, Bowland K, Halper-Stromberg E, Kotwal A, Bennett A, Skaist A, Tang J, Cai F, Macoretta A, Liang H, Kamiyama H, Wheelan S, Lin MT, Hruban RH, Hung CF, Goldstein M, Scharpf RB, Roberts NJ, Eshleman JR. NAR Cancer. 2024 Jun 19;6(2):zcae028. doi: 10.1093/narcan/zcae028. eCollection 2024 Jun. 10.1093/narcan/zcae028 PubMed 38915758