pETDuet-1-6xHis-TEV-Nsp8
(Plasmid
#201022)
-
PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 tagged with an N-terminus His-tag followed by a TEV protease cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 6077
-
Modifications to backboneInsertion of 6xHis-TEV-Nsp8
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenon-structural protein 8
-
Alt namensp8
-
SpeciesSynthetic; Severe acute respiratory syndrome coronavirus 2
-
Insert Size (bp)657
-
MutationGene insert is codon optimized for Ecoli.
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter T7/LacO
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet-1-6xHis-TEV-Nsp8 was a gift from Sharon Rozovsky (Addgene plasmid # 201022 ; http://n2t.net/addgene:201022 ; RRID:Addgene_201022) -
For your References section:
Selenoprotein S Interacts with the Replication and Transcription Complex of SARS-CoV-2 by Binding nsp7. Ghelichkhani F, Gonzalez FA, Kapitonova MA, Rozovsky S. J Mol Biol. 2023 Apr 15;435(8):168008. doi: 10.1016/j.jmb.2023.168008. Epub 2023 Feb 10. 10.1016/j.jmb.2023.168008 PubMed 36773692