pLenti-dSaCas9-KRAB-gRNA-TRE-blast
(Plasmid
#201151)
-
PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti-dSaCas9-KRAB-blast
-
Backbone manufacturerAddgene #191654
-
Modifications to backboneCloned the expression casette including the U6 promoter, guide RNA targeting the tight TRE promoter, and guide RNA scaffold into an EcoRI site in the backbone.
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameSadCas9-KRAB
-
Alt nameKRAB-SadCas9
-
Alt namedSaCas9-KRAB
-
SpeciesSynthetic; S. aureus
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Gene/Insert 2
-
Gene/Insert namegRNA-TRE
-
SpeciesSynthetic; S. aureus
-
MutationgRNA sequence: ATCAGTGATAGAGAACGTATG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-dSaCas9-KRAB-gRNA-TRE-blast was a gift from Moshe Szyf (Addgene plasmid # 201151 ; http://n2t.net/addgene:201151 ; RRID:Addgene_201151)