Skip to main content
Addgene

pRha-ABE8e-SpCas9-NG
(Plasmid #201190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201190 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pD881-SR
  • Backbone manufacturer
    Atum
  • Total vector size (bp) 7095
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ABE8e-SpCas9-NG
  • Species
    Synthetic
  • Insert Size (bp)
    4845
  • Promoter pRhaBAD
  • Tags / Fusion Proteins
    • 8xHIS (N terminal on insert)
    • BP-NLS (N terminal on insert)
    • BP-NLS (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGAATTCAGGCGCTTTTTAG
  • 3′ sequencing primer CAGTGAGTTGATTGCAGTCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    David Liu's lab at Broad Institute

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRha-ABE8e-SpCas9-NG was a gift from Jonathan Yen (Addgene plasmid # 201190 ; http://n2t.net/addgene:201190 ; RRID:Addgene_201190)
  • For your References section:

    Potent and uniform fetal hemoglobin induction via base editing. Mayuranathan T, Newby GA, Feng R, Yao Y, Mayberry KD, Lazzarotto CR, Li Y, Levine RM, Nimmagadda N, Dempsey E, Kang G, Porter SN, Doerfler PA, Zhang J, Jang Y, Chen J, Bell HW, Crossley M, Bhoopalan SV, Sharma A, Tisdale JF, Pruett-Miller SM, Cheng Y, Tsai SQ, Liu DR, Weiss MJ, Yen JS. Nat Genet. 2023 Jul;55(7):1210-1220. doi: 10.1038/s41588-023-01434-7. Epub 2023 Jul 3. 10.1038/s41588-023-01434-7 PubMed 37400614