SpyCatcher-P-Domain
(Plasmid
#201193)
-
PurposeExpresses furin P-domain genetically fused to SpyCatcher001 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-11b
- Backbone size w/o insert (bp) 5592
- Total vector size (bp) 6318
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyCatcher-P-Domain
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)724
-
GenBank IDX17094.1
- Promoter T7
-
Tags
/ Fusion Proteins
- SpyCatcher001 (N terminal on insert)
- HisTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BlpI (not destroyed)
- 5′ sequencing primer GGAATTGTTATCCGCTCAC
- 3′ sequencing primer TCCTCCTTTCAGCAAAAAACCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe gene was syntesized and cloned by Genscript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note insert is codon optimized for insect cell expression.
Original publication:
Zakeri B, Fierer JO, Celik E, Chittock EC, Schwarz-Linek U, Moy VT, Howarth M. Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proc Natl Acad Sci U S A. 2012 Mar 20;109(12):E690-7. doi: 10.1073/pnas.1115485109. Epub 2012 Feb 24. PMID: 22366317; PMCID: PMC3311370.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpyCatcher-P-Domain was a gift from Vesa Hytönen (Addgene plasmid # 201193 ; http://n2t.net/addgene:201193 ; RRID:Addgene_201193) -
For your References section:
Experimental VLP vaccine displaying a furin antigen elicits production of autoantibodies and is well tolerated in mice. Lampinen V, Ojanen MJT, Caro FM, Grohn S, Hankaniemi MM, Pesu M, Hytonen VP. Nanoscale Adv. 2024 Oct 9;6(24):6239-52. doi: 10.1039/d4na00483c. 10.1039/d4na00483c PubMed 39430302