Skip to main content

SpyCatcher-PEED
(Plasmid #201195)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201195 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-11b
  • Backbone size w/o insert (bp) 5676
  • Total vector size (bp) 5961
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpyCatcher-PEED
  • Alt name
    PEED
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    369
  • Promoter T7
  • Tag / Fusion Protein
    • HisTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BlpI (not destroyed)
  • 5′ sequencing primer acccctcaagacccgtttagaggcccc
  • 3′ sequencing primer tagtgagtcgtattaat
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The gene was synthesized and cloned by Genscript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original publications:
SpyCatcher:
Zakeri B, Fierer JO, Celik E, Chittock EC, Schwarz-Linek U, Moy VT, Howarth M. Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proc Natl Acad Sci U S A. 2012 Mar 20;109(12):E690-7. doi: 10.1073/pnas.1115485109. Epub 2012 Feb 24. PMID: 22366317; PMCID: PMC3311370.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SpyCatcher-PEED was a gift from Vesa Hytönen (Addgene plasmid # 201195 ; http://n2t.net/addgene:201195 ; RRID:Addgene_201195)
  • For your References section:

    Experimental VLP vaccine displaying a furin antigen elicits production of autoantibodies and is well tolerated in mice. Lampinen V, Ojanen MJT, Caro FM, Grohn S, Hankaniemi MM, Pesu M, Hytonen VP. Nanoscale Adv. 2024 Oct 9;6(24):6239-52. doi: 10.1039/d4na00483c. 10.1039/d4na00483c PubMed 39430302