pAAV-EF1_Cre
(Plasmid
#201198)
-
PurposeAAV vector for cre expression under EF1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-TRE-flex-Clover
-
Backbone manufactureraddgene Plasmid #135177
-
Modifications to backboneReplacement of TRE-flex-clover insert with EF1alpha-cre (WPRE is retained)
-
Vector typeMammalian Expression, Bacterial Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecre
-
Insert Size (bp)1053
-
Mutationnuclear targeting cre
-
GenBank ID
- Promoter hEF1alpha promoter
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTGAAGTTAGGCCAGCTTGG
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEF1alpha promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)376
- Promoter N/A
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer N/A
- 3′ sequencing primer N/A (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1_Cre was a gift from Tetsuo Yamamori (Addgene plasmid # 201198 ; http://n2t.net/addgene:201198 ; RRID:Addgene_201198) -
For your References section:
Local and long-distance organization of prefrontal cortex circuits in the marmoset brain. Watakabe A, Skibbe H, Nakae K, Abe H, Ichinohe N, Rachmadi MF, Wang J, Takaji M, Mizukami H, Woodward A, Gong R, Hata J, Van Essen DC, Okano H, Ishii S, Yamamori T. Neuron. 2023 May 9:S0896-6273(23)00338-0. doi: 10.1016/j.neuron.2023.04.028. 10.1016/j.neuron.2023.04.028 PubMed 37196659