pAAVCam1.3_smFP_HA
(Plasmid
#201206)
-
PurposeAAV vector for camKII promoter (1.3kb)-driven smFP_HA (HA-tagged spaghetti monster) expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAVTRE3_Clover
-
Backbone manufactureraddgene Plasmid #135179
-
Modifications to backboneReplacement of TRE3G promoter with mouse CamKII (1.3kb) promoter by MluI-EcoRI cloning.
-
Vector typeMammalian Expression, Bacterial Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmFP _HA (from addgene #59759)
-
SpeciesSynthetic
- Promoter mouse CamKII (1.3kb)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer atcacttgtggactaagtttgt
- 3′ sequencing primer cagcaaccaggatttatacaagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byLooger lab (from addgene #59759)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVCam1.3_smFP_HA was a gift from Tetsuo Yamamori (Addgene plasmid # 201206 ; http://n2t.net/addgene:201206 ; RRID:Addgene_201206) -
For your References section:
Serial Two-Photon Tomography of the Whole Marmoset Brain for Neuroanatomical Analyses. Watakabe A, Tani T, Abe H, Skibbe H, Ichinohe N, Yamamori T. J Vis Exp. 2025 Jan 17;(215). doi: 10.3791/67694. 10.3791/67694 PubMed 39895625