Skip to main content

AAVTRE3_smFP_HA
(Plasmid #201209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAVTRE3_Clover
  • Backbone manufacturer
    addgene Plasmid #135179
  • Modifications to backbone
    Replacement of clover insert with smFP_HA (WPRE is retained)
  • Vector type
    Mammalian Expression, Bacterial Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    smFP _HA (addgene plasmid #59759)
  • Species
    Synthetic
  • Promoter TRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ATAAGCTTTAGGCGTGTACGGT
  • 3′ sequencing primer cagcaaccaggatttatacaagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Looger lab (from addgene #59759)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVTRE3_smFP_HA was a gift from Tetsuo Yamamori (Addgene plasmid # 201209 ; http://n2t.net/addgene:201209 ; RRID:Addgene_201209)
  • For your References section:

    Serial Two-Photon Tomography of the Whole Marmoset Brain for Neuroanatomical Analyses. Watakabe A, Tani T, Abe H, Skibbe H, Ichinohe N, Yamamori T. J Vis Exp. 2025 Jan 17;(215). doi: 10.3791/67694. 10.3791/67694 PubMed 39895625