Skip to main content

pCDNA3.1-ADGRL3-Flag
(Plasmid #201218)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201218 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 10042
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADGRL3
  • Alt name
    Lphn3
  • Alt name
    Latrophilin-3
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Adgrl3 (a.k.a. 5430402I23Rik, CIRL-3, D130075K09Rik, Gm1379, LEC3, Lphn3, mKIAA0768)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3.1-ADGRL3-Flag was a gift from Jonathan Javitch (Addgene plasmid # 201218 ; http://n2t.net/addgene:201218 ; RRID:Addgene_201218)
  • For your References section:

    Disentangling autoproteolytic cleavage from tethered agonist-dependent activation of the adhesion receptor ADGRL3. Perry-Hauser NA, VanDyck MW, Lee KH, Shi L, Javitch JA. J Biol Chem. 2022 Dec;298(12):102594. doi: 10.1016/j.jbc.2022.102594. Epub 2022 Oct 14. 10.1016/j.jbc.2022.102594 PubMed 36244455