Skip to main content

pT2/sh-FYN1-GFP_Seq_C
(Plasmid #201399)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201399 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT2
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FYN
  • gRNA/shRNA sequence
    CTCGAGTGCTGTTGACAGTGAGCGCCCACACTAACTTCCTGTATAATAGTGAAGCCACAGATGTATTATACAGGAAGTTAGTGTGGTTGCCTACTGCCTCGGAGAATTC
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2/sh-FYN1-GFP_Seq_C was a gift from Maria Castro (Addgene plasmid # 201399 ; http://n2t.net/addgene:201399 ; RRID:Addgene_201399)
  • For your References section:

    Fyn tyrosine kinase, a downstream target of receptor tyrosine kinases, modulates antiglioma immune responses. Comba A, Dunn PJ, Argento AE, Kadiyala P, Ventosa M, Patel P, Zamler DB, Nunez FJ, Zhao L, Castro MG, Lowenstein PR. Neuro Oncol. 2020 Jun 9;22(6):806-818. doi: 10.1093/neuonc/noaa006. 10.1093/neuonc/noaa006 PubMed 31950181