pT2/sh-FYN1-GFP_Seq_C
(Plasmid
#201399)
-
PurposeKnockdown of FYN tyrosine kinase. Construct has inverted repeats to be used in Sleeping Beauty transposon system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFYN
-
gRNA/shRNA sequenceCTCGAGTGCTGTTGACAGTGAGCGCCCACACTAACTTCCTGTATAATAGTGAAGCCACAGATGTATTATACAGGAAGTTAGTGTGGTTGCCTACTGCCTCGGAGAATTC
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2/sh-FYN1-GFP_Seq_C was a gift from Maria Castro (Addgene plasmid # 201399 ; http://n2t.net/addgene:201399 ; RRID:Addgene_201399) -
For your References section:
Fyn tyrosine kinase, a downstream target of receptor tyrosine kinases, modulates antiglioma immune responses. Comba A, Dunn PJ, Argento AE, Kadiyala P, Ventosa M, Patel P, Zamler DB, Nunez FJ, Zhao L, Castro MG, Lowenstein PR. Neuro Oncol. 2020 Jun 9;22(6):806-818. doi: 10.1093/neuonc/noaa006. 10.1093/neuonc/noaa006 PubMed 31950181