pHIE324-ZF6x12-C DsRed-Express2 in TUPV1
(Plasmid
#201536)
-
PurposeDsRed-Express2 reporter regulated by ZF6 synTF promoter (12x compact binding sites) in TUPV1 for mMoClo golden gate-based assembly
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD561 TUPV1 CAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDsRed-Express2
-
SpeciesH. sapiens (human)
- Promoter ZF6x12(C)_YB_TATA Minimal Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.29.538810 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIE324-ZF6x12-C DsRed-Express2 in TUPV1 was a gift from Joshua Leonard (Addgene plasmid # 201536 ; http://n2t.net/addgene:201536 ; RRID:Addgene_201536) -
For your References section:
Enhancing extracellular vesicle cargo loading and functional delivery by engineering protein-lipid interactions. Peruzzi JA, Gunnels TF, Edelstein HI, Lu P, Baker D, Leonard JN, Kamat NP. Nat Commun. 2024 Jul 4;15(1):5618. doi: 10.1038/s41467-024-49678-z. 10.1038/s41467-024-49678-z PubMed 38965227