pPD1178-LPDV promoterless PuroR-P2A-miRFP720
(Plasmid
#201537)
-
PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPD630 Destination Vector
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePromoterless PuroR-P2A-miRFP720
-
SpeciesH. sapiens (human)
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAGATTATCAAAAAGGATCTTCACCTAGATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.29.538810 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPD1178-LPDV promoterless PuroR-P2A-miRFP720 was a gift from Joshua Leonard (Addgene plasmid # 201537 ; http://n2t.net/addgene:201537 ; RRID:Addgene_201537) -
For your References section:
Enhancing extracellular vesicle cargo loading and functional delivery by engineering protein-lipid interactions. Peruzzi JA, Gunnels TF, Edelstein HI, Lu P, Baker D, Leonard JN, Kamat NP. Nat Commun. 2024 Jul 4;15(1):5618. doi: 10.1038/s41467-024-49678-z. 10.1038/s41467-024-49678-z PubMed 38965227