Skip to main content

pAc5.1-V5-HisB-ObKHC-K282R-HaloTag
(Plasmid #201552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201552 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAc5.1 V5-HisB
  • Backbone size w/o insert (bp) 5329
  • Total vector size (bp) 7912
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kinesin-1
  • Alt name
    KIF5
  • Species
    Octopus bimaculoides
  • Insert Size (bp)
    2580
  • Mutation
    changed lysine 282 to arginine (numbering based off native gene), codon optimized for Drosophila expression
  • GenBank ID
    XP_014767912
  • Promoter Ac5
  • Tag / Fusion Protein
    • HaloTag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCCAGCAGTCGTCTAATC
  • 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAc5.1-V5-HisB-ObKHC-K282R-HaloTag was a gift from Joshua Rosenthal (Addgene plasmid # 201552 ; http://n2t.net/addgene:201552 ; RRID:Addgene_201552)
  • For your References section:

    Temperature-dependent RNA editing in octopus extensively recodes the neural proteome. Birk MA, Liscovitch-Brauer N, Dominguez MJ, McNeme S, Yue Y, Hoff JD, Twersky I, Verhey KJ, Sutton RB, Eisenberg E, Rosenthal JJC. Cell. 2023 Jun 8;186(12):2544-2555.e13. doi: 10.1016/j.cell.2023.05.004. Epub 2023 Jun 8. 10.1016/j.cell.2023.05.004 PubMed 37295402