pAc5.1-V5-HisB-ObKHC-K282R-HaloTag
(Plasmid
#201552)
-
PurposeExpresses Octopus kinesin-1 motor with K282R mutation with HaloTag in Drosophila S2 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAc5.1 V5-HisB
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 7912
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKinesin-1
-
Alt nameKIF5
-
SpeciesOctopus bimaculoides
-
Insert Size (bp)2580
-
Mutationchanged lysine 282 to arginine (numbering based off native gene), codon optimized for Drosophila expression
-
GenBank IDXP_014767912
- Promoter Ac5
-
Tag
/ Fusion Protein
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCCAGCAGTCGTCTAATC
- 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc5.1-V5-HisB-ObKHC-K282R-HaloTag was a gift from Joshua Rosenthal (Addgene plasmid # 201552 ; http://n2t.net/addgene:201552 ; RRID:Addgene_201552) -
For your References section:
Temperature-dependent RNA editing in octopus extensively recodes the neural proteome. Birk MA, Liscovitch-Brauer N, Dominguez MJ, McNeme S, Yue Y, Hoff JD, Twersky I, Verhey KJ, Sutton RB, Eisenberg E, Rosenthal JJC. Cell. 2023 Jun 8;186(12):2544-2555.e13. doi: 10.1016/j.cell.2023.05.004. Epub 2023 Jun 8. 10.1016/j.cell.2023.05.004 PubMed 37295402