p202-Syt1-C2A-wt
(Plasmid
#201553)
-
PurposeExpresses wild-type Octopus synaptotagmin-1 C2A domain in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep202
- Backbone size w/o insert (bp) 6442
- Total vector size (bp) 6838
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSynaptotagmin-1 C2A domain (partial)
-
Alt nameSYT1
-
SpeciesSynthetic; Octopus bimaculoides
-
Insert Size (bp)396
-
MutationCodon-optimized for E. coli
- Promoter RBS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTATTTTCAAGGTGATATTACTCATATGGTG
- 3′ sequencing primer TCAGTGGTGGTGGTGGTGGTGCTCGAGttac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p202-Syt1-C2A-wt was a gift from Joshua Rosenthal (Addgene plasmid # 201553 ; http://n2t.net/addgene:201553 ; RRID:Addgene_201553) -
For your References section:
Temperature-dependent RNA editing in octopus extensively recodes the neural proteome. Birk MA, Liscovitch-Brauer N, Dominguez MJ, McNeme S, Yue Y, Hoff JD, Twersky I, Verhey KJ, Sutton RB, Eisenberg E, Rosenthal JJC. Cell. 2023 Jun 8;186(12):2544-2555.e13. doi: 10.1016/j.cell.2023.05.004. Epub 2023 Jun 8. 10.1016/j.cell.2023.05.004 PubMed 37295402