Skip to main content

LENTICRISPR-TKT_sgRNA1
(Plasmid #201624)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201624 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene #52961
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TKT
  • gRNA/shRNA sequence
    GAAACAAGCTTTCACCGACG
  • Species
    H. sapiens (human)
  • Entrez Gene
    TKT (a.k.a. HEL-S-48, HEL107, SDDHD, TK, TKT1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LENTICRISPR-TKT_sgRNA1 was a gift from Alexis Jourdain & Vamsi Mootha (Addgene plasmid # 201624 ; http://n2t.net/addgene:201624 ; RRID:Addgene_201624)
  • For your References section:

    Salvage of ribose from uridine or RNA supports glycolysis in nutrient-limited conditions. Skinner OS, Blanco-Fernandez J, Goodman RP, Kawakami A, Shen H, Kemeny LV, Joesch-Cohen L, Rees MG, Roth JA, Fisher DE, Mootha VK, Jourdain AA. Nat Metab. 2023 May;5(5):765-776. doi: 10.1038/s42255-023-00774-2. Epub 2023 May 17. 10.1038/s42255-023-00774-2 PubMed 37198474