pRN3P_T3_ABE8e_IVT
(Plasmid
#201676)
-
PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRN3P
-
Backbone manufacturerTorres-Padilla et al., 2007
- Backbone size w/o insert (bp) 3202
- Total vector size (bp) 8054
-
Vector typeCRISPR ; Vector for in-vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow solid and liquid cultures at 30°C if there are issues with plasmid stability.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameecTadA(8e)-nSpCas9
-
Alt nameAdenine Base Editor 8e
-
Insert Size (bp)4852
- Promoter T3 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagctatgaccatgattacgcc
- 3′ sequencing primer gactcactatagggcgaattgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byABE8e was a gift from David Liu (Addgene plasmid # 138489 ; http://n2t.net/addgene:138489 ; RRID:Addgene_138489). The in-vitro transcription backbone was published by Torres-Padilla et al., 2007.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA and Liu DR. Nat Biotechnol (2020) 10.1038/s41587-020-0453-z
Please note that the Addgene NGS result has ambiguous bases in the 3'UTR due to difficulty sequencing through the poly A region.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN3P_T3_ABE8e_IVT was a gift from Timo Otonkoski (Addgene plasmid # 201676 ; http://n2t.net/addgene:201676 ; RRID:Addgene_201676) -
For your References section:
Genetic and functional correction of argininosuccinate lyase deficiency using CRISPR adenine base editors. Jalil S, Keskinen T, Juutila J, Sartori Maldonado R, Euro L, Suomalainen A, Lapatto R, Kuuluvainen E, Hietakangas V, Otonkoski T, Hyvonen ME, Wartiovaara K. Am J Hum Genet. 2024 Apr 4;111(4):714-728. doi: 10.1016/j.ajhg.2024.03.004. 10.1016/j.ajhg.2024.03.004 PubMed 38579669