Skip to main content

pRN3P_T3_ABE8e_IVT
(Plasmid #201676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRN3P
  • Backbone manufacturer
    Torres-Padilla et al., 2007
  • Backbone size w/o insert (bp) 3202
  • Total vector size (bp) 8054
  • Vector type
    CRISPR ; Vector for in-vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow solid and liquid cultures at 30°C if there are issues with plasmid stability.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ecTadA(8e)-nSpCas9
  • Alt name
    Adenine Base Editor 8e
  • Insert Size (bp)
    4852
  • Promoter T3 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagctatgaccatgattacgcc
  • 3′ sequencing primer gactcactatagggcgaattgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ABE8e was a gift from David Liu (Addgene plasmid # 138489 ; http://n2t.net/addgene:138489 ; RRID:Addgene_138489). The in-vitro transcription backbone was published by Torres-Padilla et al., 2007.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA and Liu DR. Nat Biotechnol (2020) 10.1038/s41587-020-0453-z

Please note that the Addgene NGS result has ambiguous bases in the 3'UTR due to difficulty sequencing through the poly A region.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRN3P_T3_ABE8e_IVT was a gift from Timo Otonkoski (Addgene plasmid # 201676 ; http://n2t.net/addgene:201676 ; RRID:Addgene_201676)
  • For your References section:

    Genetic and functional correction of argininosuccinate lyase deficiency using CRISPR adenine base editors. Jalil S, Keskinen T, Juutila J, Sartori Maldonado R, Euro L, Suomalainen A, Lapatto R, Kuuluvainen E, Hietakangas V, Otonkoski T, Hyvonen ME, Wartiovaara K. Am J Hum Genet. 2024 Apr 4;111(4):714-728. doi: 10.1016/j.ajhg.2024.03.004. 10.1016/j.ajhg.2024.03.004 PubMed 38579669