pAcBAC3-POLY-pnRFP
(Plasmid
#201680)
-
PurposeBoost the expression of pnRFP in mammalian cells (e.g., macrophage RAW 264.7 cells)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201680 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAcBAC3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name813
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer ACCATGGGCTCGAGAATAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.04.13.536636v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcBAC3-POLY-pnRFP was a gift from Huiwang Ai (Addgene plasmid # 201680 ; http://n2t.net/addgene:201680 ; RRID:Addgene_201680) -
For your References section:
Development, Characterization, and Structural Analysis of a Genetically Encoded Red Fluorescent Peroxynitrite Biosensor. Pang Y, Huang M, Fan Y, Yeh HW, Xiong Y, Ng HL, Ai HW. ACS Chem Biol. 2023 Jun 16;18(6):1388-1397. doi: 10.1021/acschembio.3c00139. Epub 2023 May 15. 10.1021/acschembio.3c00139 PubMed 37185019