pEJS2601_AAV-Nme2-ABE8e-i1-U6-2xSapI
(Plasmid
#201683)
-
PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1 and U6 sgRNA cassette. SapI enables cloning new spacers.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene #199261 (pEJS-HZ79)
- Total vector size (bp) 7478
-
Modifications to backboneContains U6-driven sgRNA cassette
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNme2-ABE8e-i1
-
Insert Size (bp)3987
- Promoter U1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCATATCATGCTGTTCAGG
- 3′ sequencing primer ctagagcgcttacacaaaaaacca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.14.536905 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS2601_AAV-Nme2-ABE8e-i1-U6-2xSapI was a gift from Erik Sontheimer (Addgene plasmid # 201683 ; http://n2t.net/addgene:201683 ; RRID:Addgene_201683) -
For your References section:
Domain-inlaid Nme2Cas9 adenine base editors with improved activity and targeting scope. Bamidele N, Zhang H, Dong X, Cheng H, Gaston N, Feinzig H, Cao H, Kelly K, Watts JK, Xie J, Gao G, Sontheimer EJ. Nat Commun. 2024 Feb 17;15(1):1458. doi: 10.1038/s41467-024-45763-5. 10.1038/s41467-024-45763-5 PubMed 38368418