pMaSat-miRFP670 pc3944
(Plasmid
#201695)
-
PurposeExpresses of miRFP-tagged MaSat in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmiRFP670-N1 (pc3379)
- Total vector size (bp) 5456
-
Modifications to backboneTo create a miRFP-tagged MaSat (pc3944), pmiRFP670-N1 (pc3379) was used and MaSat-GFP (pc1803) was cut with SacI and AgeI and fused with miRFP670.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMaSat Synthetic construct zinc finger
-
Alt nameMajor Satellites Synthetic construct zinc finger
-
Alt namezinc finger
-
SpeciesSynthetic
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- miRFP670 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer ATCCACCGGTCGCCACCATGGTA
- 3′ sequencing primer AAATGTACAGGCTCTCAAGCGCGGTGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMaSat-miRFP670 pc3944 was a gift from Cristina Cardoso (Addgene plasmid # 201695 ; http://n2t.net/addgene:201695 ; RRID:Addgene_201695) -
For your References section:
Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023