Skip to main content

pMaSat-miRFP670 pc3944
(Plasmid #201695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201695 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmiRFP670-N1 (pc3379)
  • Total vector size (bp) 5456
  • Modifications to backbone
    To create a miRFP-tagged MaSat (pc3944), pmiRFP670-N1 (pc3379) was used and MaSat-GFP (pc1803) was cut with SacI and AgeI and fused with miRFP670.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MaSat Synthetic construct zinc finger
  • Alt name
    Major Satellites Synthetic construct zinc finger
  • Alt name
    zinc finger
  • Species
    Synthetic
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • miRFP670 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer ATCCACCGGTCGCCACCATGGTA
  • 3′ sequencing primer AAATGTACAGGCTCTCAAGCGCGGTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMaSat-miRFP670 pc3944 was a gift from Cristina Cardoso (Addgene plasmid # 201695 ; http://n2t.net/addgene:201695 ; RRID:Addgene_201695)
  • For your References section:

    Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023