Skip to main content
Addgene
Open Menu

pGFP-mTet1-Cys pc2332
(Plasmid #201696)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201696 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    GFP Tet1 (pc2271)
  • Total vector size (bp) 7538
  • Modifications to backbone
    GFP-tagged Tet1-Cys (pc2332) was generated by amplifying the respective sequences from full-length Tet1 and replacing the full-length Tet1 sequence (pc2271) with AsiSI and NotI restriction.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet1 Cys
  • Alt name
    Tet1 Cysteine Rich Domain
  • Species
    M. musculus (mouse)
  • Mutation
    Only GFP-tagged Cysteine Rich Domain (CRD) of Tet1
  • GenBank ID
    NM_001406381.1
  • Entrez Gene
    Tet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer aaaagcgatcgcatggaagctgcaccctgtgactg
  • 3′ sequencing primer gaatgcggccgcttacccaaacttacagcc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-mTet1-Cys pc2332 was a gift from Cristina Cardoso (Addgene plasmid # 201696 ; http://n2t.net/addgene:201696 ; RRID:Addgene_201696)

  • For your References section:

    Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023
Related items: