pGFP-mVprBP pc2953
(Plasmid
#201698)
-
PurposeExpresses of GFP-tagged VprBP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201698 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGFP-TDG (pc2422)
- Backbone size w/o insert (bp) 8297
- Total vector size (bp) 11553
-
Modifications to backboneTo obtain a GFP-tagged VprBP (pc2953), the VprBP coding sequence was excised from the mCherry-VprBP vector (pc2954) and used to replace the TDG sequence in GFP-TDG (pc2422).
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVprBP
-
Alt nameDCAF1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4532
-
Entrez GeneDcaf1 (a.k.a. B930007L02Rik, Vprbp, mKIAA0800)
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GTCTCTCTTCCCCGGACCCCTCG
- 3′ sequencing primer CGAGGGGTCCGGGGAAGAGAGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-mVprBP pc2953 was a gift from Cristina Cardoso (Addgene plasmid # 201698 ; http://n2t.net/addgene:201698 ; RRID:Addgene_201698) -
For your References section:
Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023