Skip to main content

pGFP-mVprBP pc2953
(Plasmid #201698)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201698 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    GFP-TDG (pc2422)
  • Backbone size w/o insert (bp) 8297
  • Total vector size (bp) 11553
  • Modifications to backbone
    To obtain a GFP-tagged VprBP (pc2953), the VprBP coding sequence was excised from the mCherry-VprBP vector (pc2954) and used to replace the TDG sequence in GFP-TDG (pc2422).
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VprBP
  • Alt name
    DCAF1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4532
  • Entrez Gene
    Dcaf1 (a.k.a. B930007L02Rik, Vprbp, mKIAA0800)
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsiSI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GTCTCTCTTCCCCGGACCCCTCG
  • 3′ sequencing primer CGAGGGGTCCGGGGAAGAGAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-mVprBP pc2953 was a gift from Cristina Cardoso (Addgene plasmid # 201698 ; http://n2t.net/addgene:201698 ; RRID:Addgene_201698)
  • For your References section:

    Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023