pGFP-mTet1s-delCys pc3904
(Plasmid
#201702)
-
PurposeExpresses of GFP-tagged mTet1s-delCys in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP-Tet1 (pc2271)
- Backbone size w/o insert (bp) 6977
- Total vector size (bp) 10706
-
Modifications to backboneThe sequences encoding the CRD of GFP-Tet1s (pc3904) were deleted by overlap-extension PCR and the amplicon obtained was used to replace the Tet1 coding sequence in EGFP-Tet1 (pc2271).
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet1s
-
Alt nameTet1s Cysteine rich domain deletion
-
SpeciesM. musculus (mouse)
-
MutationDeletion of the Cysteine rich domain of Tet1s
-
Entrez GeneTet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATAAGCAGCGATCGCATGGACTGCAGTAGAC
- 3′ sequencing primer CGTTAACTGCGGCCGCTTAGACCCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-mTet1s-delCys pc3904 was a gift from Cristina Cardoso (Addgene plasmid # 201702 ; http://n2t.net/addgene:201702 ; RRID:Addgene_201702) -
For your References section:
Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023