pmcherry-mTet1s pc3905
(Plasmid
#201703)
-
PurposeExpresses of mcherry-tagged mTet1s in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGFP-Uhrf1 (pc1756)
- Backbone size w/o insert (bp) 9322
- Total vector size (bp) 11224
-
Modifications to backboneA GFP-tagged construct encoding the short isoform of Tet1 (pc3901) was generated by amplifying the respective fragment from full-length Tet1 (pc2271) and replacing the full-length Tet1 sequence with the Tet1s sequence by restriction with AsiSI and NotI. Mcherry-tagged Tet1s (pc3905) was generated by replacing the sequence of Uhrf1 (pc1756) with the Tet1s sequence just described using AsiSI and NotI restriction enzymes.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet1s
-
Alt nameTet1 short isoform
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)9092
-
Entrez GeneTet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATAAGCAGCGATCGCATGGACTGCAGTAGAC
- 3′ sequencing primer ATAAGCAGCGGCCGCTTAGACCCAACGATTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmcherry-mTet1s pc3905 was a gift from Cristina Cardoso (Addgene plasmid # 201703 ; http://n2t.net/addgene:201703 ; RRID:Addgene_201703) -
For your References section:
Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023