pGFP-mTet1s_K852R pc3914
(Plasmid
#201704)
-
PurposeExpresses of GFP-tagged mTet1s_K852R in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneGFP-tagged construct encoding the catalitic domain of Tet1 (pc2315)
- Backbone size w/o insert (bp) 9095
- Total vector size (bp) 9095
-
Modifications to backboneTo mutate lysine 852 in Tet1-CD (pc2315) to arginine (pc3914), a sequence- and ligation-independent cloning approach was chosen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet1s-K852R
-
Alt nameTet1 short isoform
-
SpeciesM. musculus (mouse)
-
MutationLysine 852 mutated to arginine
-
Entrez GeneTet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
- Promoter CAG
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAACGGCTGTCGGTTTGGGAGGAG
- 3′ sequencing primer CTCCTCCCAAACCGACAGCCGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-mTet1s_K852R pc3914 was a gift from Cristina Cardoso (Addgene plasmid # 201704 ; http://n2t.net/addgene:201704 ; RRID:Addgene_201704) -
For your References section:
Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023