ptHe-Tub2D3-mScarlet
(Plasmid
#201733)
-
PurposeTardigrade (Hypsibius exemplaris) beta-tubulin Tub2D3 tagged with mScarlet for expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmScarlet-N1
- Backbone size w/o insert (bp) 4666
- Total vector size (bp) 6076
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTubulin Beta D3
-
Alt nametHe-Tub2D3
-
SpeciesHypsibius exemplaris
-
Insert Size (bp)1341
-
GenBank IDOQ282846.1
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV Forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV-40 pA Reverse (GAAATTTGTGATGCTATTGC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptHe-Tub2D3-mScarlet was a gift from Stanislav Vinopal (Addgene plasmid # 201733 ; http://n2t.net/addgene:201733 ; RRID:Addgene_201733) -
For your References section:
Phylogenetic and functional characterization of water bears (Tardigrada) tubulins. Novotna Floriancicova K, Baltzis A, Smejkal J, Czernekova M, Kaczmarek L, Maly J, Notredame C, Vinopal S. Sci Rep. 2023 Mar 30;13(1):5194. doi: 10.1038/s41598-023-31992-z. 10.1038/s41598-023-31992-z PubMed 36997657