-
PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201912 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Total vector size (bp) 4957
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJRH-1362 scFv entry plasmid was a gift from Jennifer Doudna (Addgene plasmid # 201912 ; http://n2t.net/addgene:201912 ; RRID:Addgene_201912) -
For your References section:
In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493