pAG416GAL10-CCHFV_OTU
(Plasmid
#201945)
-
PurposeExpresses CCHFV OTU domain of L protein from a GAL10 promoter with a URA3 marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAG416GAL10-ccdB-6stop
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCCHFV OTU domain of L protein
-
Alt nameCrimean-Congo Hemorrhagic Fever Virus OTU domain of L protein
-
Entrez GeneRdRp (a.k.a. CCFHV_sLgp1)
- Promoter GAL10
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tggggctctttacatttcca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid expresses a 169 amino acid construct (507 bp), which constitutes the Ovarian Tumor (OTU) motif within the larger L segment (total 12 kb) of CCHFV.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG416GAL10-CCHFV_OTU was a gift from Alejandro Chavez (Addgene plasmid # 201945 ; http://n2t.net/addgene:201945 ; RRID:Addgene_201945) -
For your References section:
A multiplex method for rapidly identifying viral protease inhibitors. Hong SJ, Resnick SJ, Iketani S, Cha JW, Albert BA, Fazekas CT, Chang CW, Liu H, Dagan S, Abagyan MR, Fajtova P, Culbertson B, Brace B, Reddem ER, Forouhar F, Glickman JF, Balkovec JM, Stockwell BR, Shapiro L, O'Donoghue AJ, Sabo Y, Freundlich JS, Ho DD, Chavez A. Mol Syst Biol. 2025 Feb;21(2):158-172. doi: 10.1038/s44320-024-00082-1. Epub 2025 Jan 6. 10.1038/s44320-024-00082-1 PubMed 39762652