pAAV-TRE-IEo
(Plasmid
#201992)
-
PurposeAAV vector mediating inducible expression of codon optimized immediate early gene IE180 of pseudorabies virus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV2
-
Backbone manufacturer3358
- Total vector size (bp) 7720
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInducible expression of codon optimized immediate early gene IE180 of pseudorabies virus
-
SpeciesSynthetic
-
Insert Size (bp)4362
-
GenBank IDWill provide once we obtain it
- Promoter Tight TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtatgtcgaggtaggcgtgtacgg
- 3′ sequencing primer ataagatacattgatgagtttgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE-IEo was a gift from Wei Xu (Addgene plasmid # 201992 ; http://n2t.net/addgene:201992 ; RRID:Addgene_201992) -
For your References section:
Directed stepwise tracing of polysynaptic neuronal circuits with replication-deficient pseudorabies virus. Du W, Li E, Guo J, Arano R, Kim Y, Chen YT, Thompson A, Oh SJ, Samuel A, Li Y, Oyibo HK, Xu W. Cell Rep Methods. 2023 Jun 16;3(6):100506. doi: 10.1016/j.crmeth.2023.100506. eCollection 2023 Jun 26. 10.1016/j.crmeth.2023.100506 PubMed 37426757