pEF1a-PEmax-P2A-GFP
              
              
                (Plasmid
                
                #202000)
              
            
            
            
          - 
            PurposeBased on the pCMV-PEmax-P2A-GFP, we replaced the CMP promoter with the EF1a promoter for expression in iPSC.
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCMV-PEmax-P2A-GFP
- Total vector size (bp) 11128
- 
              Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namePEmax-P2A-GFP
- 
                    SpeciesSynthetic; SpCas9 is from Streptococcus pyogenes
- 
                  Insert Size (bp)7143
- 
                    GenBank IDNA
- Promoter EF1a
- 
    
        Tag
        / Fusion Protein
    - GFP (C terminal on insert)
 
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgatgtacgggccagatataggctccggtgcccgtcag
- 3′ sequencing primer ctatagtgagtcgtattagctcacgacacctgaaatggaagaaaaaaactttgaacc (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pEF1a-PEmax-P2A-GFP was a gift from Daniel Geschwind (Addgene plasmid # 202000 ; http://n2t.net/addgene:202000 ; RRID:Addgene_202000)
 
    
 
                         
             
            