hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry
(Plasmid
#202090)
-
PurposeNeuron-specific expression vector of catalytically-dead dCas9-Set2 containing R195G and C201A mutations
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonehSyn-GW-IRES2-mCherry
- Backbone size w/o insert (bp) 8173
- Total vector size (bp) 14710
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-Set2(R195G, C201A)
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)6537
-
MutationR195G and C201A abolish catalytic activity
- Promoter human Synapsin
-
Tags
/ Fusion Proteins
- 3x FLAG (N terminal on insert)
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GATAGTGACCTGTTCGTTGC
- 3′ sequencing primer CCAACTTTGTACAAGAAAGCTGGGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry was a gift from Elizabeth Heller (Addgene plasmid # 202090 ; http://n2t.net/addgene:202090 ; RRID:Addgene_202090) -
For your References section:
Chromatin-mediated alternative splicing regulates cocaine-reward behavior. Xu SJ, Lombroso SI, Fischer DK, Carpenter MD, Marchione DM, Hamilton PJ, Lim CJ, Neve RL, Garcia BA, Wimmer ME, Pierce RC, Heller EA. Neuron. 2021 Sep 15;109(18):2943-2966.e8. doi: 10.1016/j.neuron.2021.08.008. Epub 2021 Sep 3. 10.1016/j.neuron.2021.08.008 PubMed 34480866