Skip to main content
Addgene

pCMV-MTS-FLAG-LOV*
(Plasmid #202207)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202207 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
  • Alt name
    Mitochondria targeting sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    432
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • LOV* (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-MTS-FLAG-LOV* was a gift from Thomas Muir (Addgene plasmid # 202207 ; http://n2t.net/addgene:202207 ; RRID:Addgene_202207)
  • For your References section:

    A genetically encoded photoproximity labeling approach for mapping protein territories. Hananya N, Ye X, Koren S, Muir TW. Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10. 10.1073/pnas.2219339120 PubMed 37036999