eft-3p:act-5(ptc):tbb2 3' UTR
(Plasmid
#202331)
-
PurposeThe ubiquitous eft-3 promoter drives overexpression of the mutant act-5(ptc) gene including introns.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFJ1662
- Backbone size w/o insert (bp) 2981
- Total vector size (bp) 5692
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameeft-3 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)600
-
GenBank IDWBGene00001168
- Promoter This is a promoter sequence for C. elegans eft-3
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ttgagtgagctgataccgca
- 3′ sequencing primer GGTAAGGAGAACTGGGTGTTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameact-5(ptc)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1730
-
GenBank IDWBGene00000067
- Promoter eft-3
-
Tag
/ Fusion Protein
- base 238 C -> A mutation causing a PTC at codon 79
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer attctctctaccgtccgcac
- 3′ sequencing primer agcattcacttcactcagatgc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametbb-2 3' UTR
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)324
-
GenBank IDWBGene00006537
- Promoter This is a terminator sequence for C. elegans tbb-2
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CACAATGAAGATCAAGATTATTGCTCCAC
- 3′ sequencing primer ctcttcgctattacgccagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eft-3p:act-5(ptc):tbb2 3' UTR was a gift from Didier Stainier (Addgene plasmid # 202331 ; http://n2t.net/addgene:202331 ; RRID:Addgene_202331) -
For your References section:
Partial sequence identity in a 25-nucleotide long element is sufficient for transcriptional adaptation in the Caenorhabditis elegans act-5/act-3 model. Welker JM, Serobyan V, Zaker Esfahani E, Stainier DYR. PLoS Genet. 2023 Jun 29;19(6):e1010806. doi: 10.1371/journal.pgen.1010806. eCollection 2023 Jun. 10.1371/journal.pgen.1010806 PubMed 37384903