pRmHa3-dKDM4A-H195A-HA2FL2
(Plasmid
#20235)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRmHa3-CHA2FL2
- Backbone size w/o insert (bp) 3990
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedKDM4A
-
Alt nameCG15835
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1488
-
Mutationchanged His 195 to Ala
-
GenBank IDNM_136487
-
Entrez GeneKdm4A (a.k.a. CG15835, dJMJD2(1), dKDM4A, Dmel\CG15835)
-
Tags
/ Fusion Proteins
- HA2 (C terminal on backbone)
- FLAG2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer agaggtgaatcgaacgaaagacccg
- 3′ sequencing primer gtagagcgtttatcagttttttgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
D153E mutation is also present, but it does affect the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRmHa3-dKDM4A-H195A-HA2FL2 was a gift from Jerry Workman (Addgene plasmid # 20235 ; http://n2t.net/addgene:20235 ; RRID:Addgene_20235) -
For your References section:
Heterochromatin protein 1a stimulates histone H3 lysine 36 demethylation by the Drosophila KDM4A demethylase. Lin CH, Li B, Swanson S, Zhang Y, Florens L, Washburn MP, Abmayr SM, Workman JL. Mol Cell. 2008 Dec 5. 32(5):696-706. 10.1016/j.molcel.2008.11.008 PubMed 19061644