pTY137 psfGFP-bimax2
(Plasmid #202410)

• Purpose: Expresses sfGFP-bimax2 to inhibit importin-alpha-mediated nuclear import
• Depositing Lab: Tim Mitchison
• Publication: Yoo et al J Cell Biol. 2021 Jul 5;220(7). pii: 212033. doi: 10.1083/jcb.202010141.

Backbone

• Vector backbone: sfGFP-C1
• Backbone size w/o insert (bp): 4750
• Total vector size (bp): 4795
• Modifications to backbone: None
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: bimax2
• Species: Synthetic
• Insert Size (bp): 78
• Promoter: CMV
• Tag / Fusion Protein:
  • sfGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhOI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • pTY137_psfGFP-bimax2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

bimax2 protein sequence (RRRRRRKRKREWDDDDDPPKKRRRLD) derived from Kosugi et al, Chemistry and Biology 2008