Skip to main content

AAV1-DIO-eGFP-pvRPL10a
(Plasmid #202542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202542 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-DIO-EGFP
  • Backbone size w/o insert (bp) 5522
  • Total vector size (bp) 6299
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RPL10a subunit of the ribosome
  • Species
    Microtus ochrogaster (Prairie Vole)
  • Insert Size (bp)
    777
  • Mutation
    optimized for prairie vole DNA sequence and optimal codon usage
  • GenBank ID
    XM_005360358.1
  • Promoter human synapsin
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc1 (unknown if destroyed)
  • 3′ cloning site BsrG1-HF (not destroyed)
  • 5′ sequencing primer agagttttcgccccgaagaac
  • 3′ sequencing primer catggtcctgctggagttcgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV1-DIO-eGFP-pvRPL10a was a gift from Zoe Donaldson (Addgene plasmid # 202542 ; http://n2t.net/addgene:202542 ; RRID:Addgene_202542)
  • For your References section:

    Prolonged partner separation erodes nucleus accumbens transcriptional signatures of pair bonding in male prairie voles. Sadino JM, Bradeen XG, Kelly CJ, Brusman LE, Walker DM, Donaldson ZR. Elife. 2023 Feb 28;12:e80517. doi: 10.7554/eLife.80517. 10.7554/eLife.80517 PubMed 36852906