AAV1-DIO-eGFP-pvRPL10a
(Plasmid
#202542)
-
PurposeCr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-DIO-EGFP
- Backbone size w/o insert (bp) 5522
- Total vector size (bp) 6299
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPL10a subunit of the ribosome
-
SpeciesMicrotus ochrogaster (Prairie Vole)
-
Insert Size (bp)777
-
Mutationoptimized for prairie vole DNA sequence and optimal codon usage
-
GenBank IDXM_005360358.1
- Promoter human synapsin
-
Tag
/ Fusion Protein
- eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (unknown if destroyed)
- 3′ cloning site BsrG1-HF (not destroyed)
- 5′ sequencing primer agagttttcgccccgaagaac
- 3′ sequencing primer catggtcctgctggagttcgtg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV1-DIO-eGFP-pvRPL10a was a gift from Zoe Donaldson (Addgene plasmid # 202542 ; http://n2t.net/addgene:202542 ; RRID:Addgene_202542) -
For your References section:
Prolonged partner separation erodes nucleus accumbens transcriptional signatures of pair bonding in male prairie voles. Sadino JM, Bradeen XG, Kelly CJ, Brusman LE, Walker DM, Donaldson ZR. Elife. 2023 Feb 28;12:e80517. doi: 10.7554/eLife.80517. 10.7554/eLife.80517 PubMed 36852906