pJB37
(Plasmid
#202602)
-
PurposeArabinose inducible expression vector expressing retron Rcat-Sen2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRcaT-Sen2 toxin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB37 was a gift from Athanasios Typas (Addgene plasmid # 202602 ; http://n2t.net/addgene:202602 ; RRID:Addgene_202602) -
For your References section:
TAC-TIC, a high-throughput genetics method to identify triggers or blockers of bacterial toxin-antitoxin systems. Bobonis J, Yang ALJ, Voogdt CGP, Typas A. Nat Protoc. 2024 May 9. doi: 10.1038/s41596-024-00988-y. 10.1038/s41596-024-00988-y PubMed 38724726