TLCV2 - sgAP2S1 #1
(Plasmid
#202756)
-
PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTLCV2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting AP2S1
-
gRNA/shRNA sequenceGATCGAGGAGGTGCATGCCG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gactatcatatgcttaccgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2 - sgAP2S1 #1 was a gift from Christopher Counter (Addgene plasmid # 202756 ; http://n2t.net/addgene:202756 ; RRID:Addgene_202756) -
For your References section:
The essential clathrin adapter protein complex-2 is tumor suppressive specifically in vivo. Zimmerman SP, DeGraw LB, Counter CM. Nat Commun. 2025 Mar 6;16(1):2254. doi: 10.1038/s41467-025-57521-2. 10.1038/s41467-025-57521-2 PubMed 40050266