TLCV2 - sgPTEN
(Plasmid
#202759)
-
PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting PTEN
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTLCV2
- Backbone size w/o insert (bp) 14852
- Total vector size (bp) 14873
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting PTEN
-
gRNA/shRNA sequenceGAACTTGTCTTCCCGTCGTG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gactatcatatgcttaccgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2 - sgPTEN was a gift from Christopher Counter (Addgene plasmid # 202759 ; http://n2t.net/addgene:202759 ; RRID:Addgene_202759) -
For your References section:
The essential clathrin adapter protein complex-2 is tumor suppressive specifically in vivo. Zimmerman SP, DeGraw LB, Counter CM. Nat Commun. 2025 Mar 6;16(1):2254. doi: 10.1038/s41467-025-57521-2. 10.1038/s41467-025-57521-2 PubMed 40050266