pWR23
(Plasmid
#202770)
-
Purposeepisomal bioluminescent reporter plasmid for S. stipitis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWR9
-
Backbone manufacturerRobertson
- Total vector size (bp) 7936
-
Modifications to backbonecoHPH hygromycin resistance cds in pWR9 was replaced with coKanMX G418 resistance cds
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTEF1 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)726
-
Entrez GeneTEF1 (a.k.a. PICST_65303)
Gene/Insert 2
-
Gene/Insert namecoKanMX
-
SpeciesSynthetic
-
Insert Size (bp)806
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACCAGTTCCTCCCATTGTAG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameACT1 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)400
Gene/Insert 4
-
Gene/Insert nameTDH3 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)749
Gene/Insert 5
-
Gene/Insert namecoCBG
-
SpeciesSynthetic
-
Insert Size (bp)1629
Gene/Insert 6
-
Gene/Insert nameADH2 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)374
Gene/Insert 7
-
Gene/Insert nameARS from S. stipitis chromosome 1
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)1148
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bycoCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR23 was a gift from J. Brian Robertson (Addgene plasmid # 202770 ; http://n2t.net/addgene:202770 ; RRID:Addgene_202770) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937