pWR76
(Plasmid
#202776)
-
Purposeepisomal fluorescent reporter plasmid for S. stipitis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202776 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWR9
-
Backbone manufacturerRobertson
- Total vector size (bp) 7237
-
Modifications to backbonecoCBG bioluminescence cds in pWR9 was replaced with coCherry red fluorescence cds
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTEF1 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)726
-
Entrez GeneTEF1 (a.k.a. PICST_65303)
Gene/Insert 2
-
Gene/Insert namecoHPH
-
SpeciesSynthetic
-
Insert Size (bp)1029
Gene/Insert 3
-
Gene/Insert nameACT1 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)400
Gene/Insert 4
-
Gene/Insert nameTDH3 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)749
Gene/Insert 5
-
Gene/Insert namecoCherry
-
Alt nameyEmRFP
-
Insert Size (bp)711
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer TTCACATTTCGAAATCCTG
- 3′ sequencing primer GCATTCAGAGTCTACACTTC (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameADH2 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)374
Gene/Insert 7
-
Gene/Insert nameARS from S. stipitis chromosome 1
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)1148
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bycoCherry that is in pWR76 (also called yEmRFP) was provided by Neta Dean (Stony Brook U) published in Keppler-Ross, S., Noffz, C., Dean, N. (2008). A new purple fluorescent color marker for genetic studies in Saccharomyces cerevisiae and Candida albicans. Genetics, 179(1), 705–710.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR76 was a gift from J. Brian Robertson (Addgene plasmid # 202776 ; http://n2t.net/addgene:202776 ; RRID:Addgene_202776) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937