Skip to main content

pWR58
(Plasmid #202795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202795 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAllet
  • Backbone manufacturer
    Robertson
  • Backbone size w/o insert (bp) 2216
  • Total vector size (bp) 9734
  • Modifications to backbone
    pWR58 was constructed by first moving the PTEF1-ShBle-TACT1 insert from pWR10 into pAllet, then upstream of this adding an insert that contained a portion of pWR9 that included the TDH3 promoter and the first two thirds of the coCBG CDS plus the 20 nucleotide YUM1 Cas9 target sequence next to a PAM. Similarly downstream of the ShBle insert an insert was added that contained the 20 nucleotide YUM1 Cas9 target sequence next to a PAM followed by a portion of pWR9 that included the last two thirds of the coCBG CDS and ADH2 terminator. Finally, the URA3 integration element from pWR9 was excised and transferred to the plasmid.
  • Vector type
    Yeast Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    P-TDH3/coCBG(first portion)-YUM1
  • Species
    Synthetic; S. stipitis (yeast)
  • Insert Size (bp)
    1854

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TCGTTAGTATTTCCGTGAAG
  • 3′ sequencing primer CCAAATCAGTGAACCTTGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    P-TEF1/ShBle/T-ACT1
  • Species
    Synthetic; S. stipitis (yeast)
  • Insert Size (bp)
    1513

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (destroyed during cloning)
  • 5′ sequencing primer ATCTACCAGCGCTAACATTC
  • 3′ sequencing primer TCTGCATGACTCCCTTTG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    YUM1-coCBG(last portion)/T-ADH2
  • Species
    Synthetic; S. stipitis (yeast)
  • Insert Size (bp)
    1467

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGTGAAGTGTATAGAATTGTGC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    URA3 and flanking sequence
  • Species
    S. stipitis (yeast)
  • Insert Size (bp)
    2754

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer CTCAGTACGAACAAGAGAATGA
  • 3′ sequencing primer CACAGGGTTGATATTGTACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    coCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWR58 was a gift from J. Brian Robertson (Addgene plasmid # 202795 ; http://n2t.net/addgene:202795 ; RRID:Addgene_202795)
  • For your References section:

    BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937