pHYX137
(Plasmid
#202814)
-
Purpose(Empty Backbone) Saccharomyces cerevisiae vector for the expression of polycistronic genes. Expression controled by the auto-inducible yeast promoter PCK1. LEU2 selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepV2A-T
- Backbone size (bp) 7779
-
Modifications to backboneInsertion of 2µ origin of replication, LEU2 selection, PCK1 promoter and PRM9 terminator from Saccharomyces cerevisiae. TetON promoter and TrpC terminator removed.
-
Vector typeYeast Expression
- Promoter ScPCK1
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer CCTGAAGAAGGAGCTCGCTC
- 3′ sequencing primer GGATCAGCTCGGCCTTGTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHYX137 was a gift from Jean-Félix Dallery (Addgene plasmid # 202814 ; http://n2t.net/addgene:202814 ; RRID:Addgene_202814) -
For your References section:
Yeast-based heterologous production of the colletochlorin family of fungal secondary metabolites. Geistodt-Kiener A, Totozafy JC, Le Goff G, Vergne J, Sakai K, Ouazzani J, Mouille G, Viaud M, O'Connell RJ, Dallery JF. Metab Eng. 2023 Oct 18:S1096-7176(23)00142-8. doi: 10.1016/j.ymben.2023.10.002. 10.1016/j.ymben.2023.10.002 PubMed 37863177