Skip to main content

pcDNA5/FRT/TO FLAG-RPS28
(Plasmid #203156)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203156 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA5 FRT/TO
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPS28
  • Species
    H. sapiens (human)
  • Entrez Gene
    RPS28 (a.k.a. DBA15, S28, eS28)
  • Promoter CMV
  • Tag / Fusion Protein
    • 1X FLAG tag with GGGGS linker (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer ATAGAAGACACCGGGACCGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://pubmed.ncbi.nlm.nih.gov/36824951/ for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5/FRT/TO FLAG-RPS28 was a gift from Susan Baserga (Addgene plasmid # 203156 ; http://n2t.net/addgene:203156 ; RRID:Addgene_203156)
  • For your References section:

    Discovery of novel microRNA mimic repressors of ribosome biogenesis. Bryant CJ, McCool MA, Rosado Gonzalez GT, Abriola L, Surovtseva YV, Baserga SJ. Nucleic Acids Res. 2024 Feb 28;52(4):1988-2011. doi: 10.1093/nar/gkad1235. 10.1093/nar/gkad1235 PubMed 38197221