pcDNA5/FRT/TO FLAG-RPS28
(Plasmid
#203156)
-
PurposeN-FLAG-RPS28 in inducible pcDNA5 vector for Flp-In integration
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5 FRT/TO
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRPS28
-
SpeciesH. sapiens (human)
-
Entrez GeneRPS28 (a.k.a. DBA15, S28, eS28)
- Promoter CMV
-
Tag
/ Fusion Protein
- 1X FLAG tag with GGGGS linker (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer ATAGAAGACACCGGGACCGA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://pubmed.ncbi.nlm.nih.gov/36824951/ for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO FLAG-RPS28 was a gift from Susan Baserga (Addgene plasmid # 203156 ; http://n2t.net/addgene:203156 ; RRID:Addgene_203156) -
For your References section:
Discovery of novel microRNA mimic repressors of ribosome biogenesis. Bryant CJ, McCool MA, Rosado Gonzalez GT, Abriola L, Surovtseva YV, Baserga SJ. Nucleic Acids Res. 2024 Feb 28;52(4):1988-2011. doi: 10.1093/nar/gkad1235. 10.1093/nar/gkad1235 PubMed 38197221